Severe Combined ImmunoDeficiency (SCID) Rat

Accelerate Translational Research and Regenerative Medicine

Nowadays, the technologies of genome editing enable us to generate various animal model. Different from mice, the laboratory rats have larger size and more relevance to human diseases and attract more attention in many fields, such as Pharmacology and Toxicology. Among numerous rat models, the immunodeficient rats have large applicability and potential in the researches of multiple are, including cancers, stem cells, organ transplantation, etc.

As a center facility of National Bio resources Project, Osaka University has started to preserve and provide immunodeficient SCID rats since 2017. This is the first approach in Japan.

Rat Strains

We provide three SCID Rat strains. All of these rats are bred at exclusive SPF room, which can be used safely. If you have any questions or something you don't understand, just let us know anytime.

NBRP Rat No. Strain Name Characteristics Genotyping*
0883 F344-Il2rgem1Iexas This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on the X chromosome.
This strain grows normally under SPF condition.
(Target) Il2rg (Product Size) Wild Type : 292 bp, Mutant : 287 bp, (Primer) TTGCTGACTTCTATGGACCTTAAA, TTCATCTGGTCTGAACTGATAACTTAT
0894 F344-Rag2em1Iexas This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3.
This strain grows normally under SPF condition.
(Target) Rag2 (Product Size) Wilde type : 381bp, Mutant : 382bp, (Primer) GGGGAGAAGGTGTCTTACGG, AGGTGGGAGGTAGCAGGAAT
0895 F344-Il2rg/Rag2em1Iexas This strain shows severe combined immunodeficiency (SCID) caused by 5-bp deletion in Il2rg gene on the X chromosome and 1-bp insertion in Rag2 gene on chromosome 3.
This strain grows normally under SPF condition. The sexual maturation is a bit late.
It can be distinguished by the combination of NBRP Rat No.0883 and 0894.
*Transgenic rats can be distinguished by PCR, electrophoresis and Sanger sequencing.

Practical Examples

References

Intestinal immunity suppresses carrying capacity of rats for the model tapeworm, Hymenolepis diminuta.
Ohno T, Kai T, Miyasaka Y, Maruyama H, Ishih A, Kino H.
Parasitol Int. 2018 Aug;67(4):357-61.

Fail-safe therapy by gamma-ray irradiation against tumor formation by human induced pluripotent stem cell-derived neural progenitors.
Katsukawa M, Nakajima Y, Fukumoto A, Doi D, Takahashi J.
Stem Cells Dev. 2016 Jun 1;25(11):815-25.

Estradiol Facilitates Functional Integration of iPSC-Derived Dopaminergic Neurons into Striatal Neuronal Circuits via Activation of Integrin α5β1.
Nishimura K, Doi D, Samata B, Murayama S, Tahara T, Onoe H, Takahashi J.
Stem Cell Reports. 2016 Apr 12;6(4):511-24.

Generation of Scaffoldless Hyaline Cartilaginous Tissue from Human iPSCs.
Yamashita A, Morioka M, Yahara Y, Okada M, Kobayashi T, Kuriyama S, Matsuda S, and Tsumaki N.
Stem Cell Reports. 2015 Mar 10;4(3):404-18.

X-linked severe combined immunodeficiency (X-SCID) rats for xeno-transplantation and behavioral evaluation.
Samata B, Kikuchi T, Miyawaki Y, Morizane A, Mashimo T, Nakagawa M, Okita K, Takahashi J.
J Neurosci Methods. 2015 Mar 30;243:68-77.

Generation and characterization of severe combined immunodeficiency rats.
Mashimo T, Takizawa A, Kobayashi J, Kunihiro Y, Yoshimi K, Ishida S, Tanabe K, Yanagi A, Tachibana A, Hirose J, Yomoda J, Morimoto S, Kuramoto T, Voigt B, Watanabe T, Hiai H, Tateno C, Komatsu K, Serikawa T.
Cell Reports. 2012 Sep 27;2(3):685-94

Generation of knockout rats with X-linked severe combined immunodeficiency (X-SCID) using zinc-finger nucleases.
Mashimo T, Takizawa A, Voigt B, Yoshimi K, Hiai H, Kuramoto T, Serikawa T.
PLoS One. 2010 Jan 25;5(1):e8870.